- Что такое биоинформатика?

Презентация "Что такое биоинформатика?" по биологии – проект, доклад

Заказать ✍️ написание учебной работы
Поможем с курсовой, контрольной, дипломной, рефератом, отчетом по практике, научно-исследовательской и любой другой работой
Слайд 1
Слайд 2
Слайд 3
Слайд 4
Слайд 5
Слайд 6
Слайд 7
Слайд 8
Слайд 9
Слайд 10
Слайд 11
Слайд 12
Слайд 13
Слайд 14
Слайд 15
Слайд 16
Слайд 17
Слайд 18
Слайд 19
Слайд 20
Слайд 21
Слайд 22
Слайд 23

Презентацию на тему "Что такое биоинформатика?" можно скачать абсолютно бесплатно на нашем сайте. Предмет проекта: Биология. Красочные слайды и иллюстрации помогут вам заинтересовать своих одноклассников или аудиторию. Для просмотра содержимого воспользуйтесь плеером, или если вы хотите скачать доклад - нажмите на соответствующий текст под плеером. Презентация содержит 23 слайд(ов).

Слайды презентации

Что такое биоинформатика? Банк SwissProt. С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ
Слайд 1

Что такое биоинформатика? Банк SwissProt

С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ

Что такое биоинформатика? Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерны
Слайд 2

Что такое биоинформатика?

Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.

?

Биоинформатика
Слайд 3

Биоинформатика

Примеры задач биоинформатики. Разработка алгоритмов для анализа большого объема биологических данных Алгоритм поиска генов в геноме Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с
Слайд 4

Примеры задач биоинформатики

Разработка алгоритмов для анализа большого объема биологических данных Алгоритм поиска генов в геноме Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами. Изучение структуры активного центра белка Разработка программного обеспечения для управления и быстрого доступа к биологическим данным Создание банка данных аминокислотных последовательностей

Что понимать под биоинформатикой? Как видим, смысл термина ещё ỳже... Применение компьютерных методов для решения биологических задач. Применение компьютерных методов для решения задач молекулярной биологии. ... и еще ỳже... Компьютерный анализ экспериментальных данных о структурах биологических мак
Слайд 5

Что понимать под биоинформатикой?

Как видим, смысл термина ещё ỳже...

Применение компьютерных методов для решения биологических задач

Применение компьютерных методов для решения задач молекулярной биологии

... и еще ỳже...

Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации

Итак... Биоинформатика = вычислительная молекулярная биология. Почему так сузился смысл термина?
Слайд 6

Итак...

Биоинформатика = вычислительная молекулярная биология

Почему так сузился смысл термина?

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataat
Слайд 7

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa

В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК. Организм ДНК «в пробирке». Последовательность. выделение секвенирование ...TGCCACAAATCAC...
Слайд 8

В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК

Организм ДНК «в пробирке»

Последовательность

выделение секвенирование ...TGCCACAAATCAC...

Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank. GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях
Слайд 9

Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank

GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях 2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов) Размер файлов — 196 Gb

Пионеры биоинформатики. Лайнус Полинг 1962. Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence in proteins. Evolving
Слайд 10

Пионеры биоинформатики

Лайнус Полинг 1962

Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166.

Анализ аминокислотных последовательностей глобинов нескольких позвоночных Гипотеза молекулярных часов

Маргарет Дейхофф. Однобуквенный код аминокислот A,C,D,E,F,G,H… Матрицы аминокислотных замен PAM (Point Accepted Mutation). 1965. Атлас последовательностей белков и их структур (1965)
Слайд 11

Маргарет Дейхофф

Однобуквенный код аминокислот A,C,D,E,F,G,H… Матрицы аминокислотных замен PAM (Point Accepted Mutation)

1965

Атлас последовательностей белков и их структур (1965)

Первый “банк данных”. Атлас белковых последовательностей и их структур. 1965 -1978. Первая версия атласа содержала описание 65 (!) последовательностей белков
Слайд 12

Первый “банк данных”

Атлас белковых последовательностей и их структур

1965 -1978

Первая версия атласа содержала описание 65 (!) последовательностей белков

Банки данных. Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор Курируемые за содержание записей отвечают специальные люди — кураторы Автоматические записи генерируются компьютерными программами
Слайд 13

Банки данных

Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор Курируемые за содержание записей отвечают специальные люди — кураторы Автоматические записи генерируются компьютерными программами

Банк данных Swiss-Prot 1986. Swiss-Prot – база знаний о белковых последовательностях. http://www.expasy.org/sprot/. Курируемая база данных “Золотой стандарт” аннотации
Слайд 14

Банк данных Swiss-Prot 1986

Swiss-Prot – база знаний о белковых последовательностях

http://www.expasy.org/sprot/

Курируемая база данных “Золотой стандарт” аннотации

Амос Байрох. Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики. С 1987 поддерживается в сотрудничестве между Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EBI)
Слайд 15

Амос Байрох

Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики

С 1987 поддерживается в сотрудничестве между Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EBI)

Статистика роста количества документов. Текущий релиз 48.9 (24 января 2006) содержит 206586 документов. 2006 2001
Слайд 16

Статистика роста количества документов

Текущий релиз 48.9 (24 января 2006) содержит 206586 документов

2006 2001

Банк данных TrEMBL. Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация. TrEMBL (Translated EMBL). Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа
Слайд 17

Банк данных TrEMBL

Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация

TrEMBL (Translated EMBL)

Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа

Тенденция объединения. 2002
Слайд 18

Тенденция объединения

2002

Банк данных UniProt. UniProt (Universal Protein Resource). UniProt Knowlegebase – SwissProt+TrEMBL UniProt Archive – UniParc UniProt Reference – UniRef
Слайд 19

Банк данных UniProt

UniProt (Universal Protein Resource)

UniProt Knowlegebase – SwissProt+TrEMBL UniProt Archive – UniParc UniProt Reference – UniRef

~2 500 000 последовательностей. компьютерный поиск гена, трансляция и компьютерная аннотация. UniRef (UniProt non-redundant Reference databases). PIR-PSD UniParc (UniProt Archive). 200 000 последовательностей. Экспертиза. Базы данных научной литературы
Слайд 20

~2 500 000 последовательностей

компьютерный поиск гена, трансляция и компьютерная аннотация

UniRef (UniProt non-redundant Reference databases)

PIR-PSD UniParc (UniProt Archive)

200 000 последовательностей

Экспертиза

Базы данных научной литературы

Соотношение числа белков, представленных в разных банках. 3 078 524 33 321 206 586. Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!
Слайд 21

Соотношение числа белков, представленных в разных банках

3 078 524 33 321 206 586

Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!

Документ банка данных Swiss-Prot. Описание документа: идентификатор, имя, дата создания и модификации. Аннотация последовательности
Слайд 22

Документ банка данных Swiss-Prot

Описание документа: идентификатор, имя, дата создания и модификации

Аннотация последовательности

Основные поля записи SwissProt. ID AC DE OS OC. И сама последовательность, конечно.
Слайд 23

Основные поля записи SwissProt

ID AC DE OS OC

И сама последовательность, конечно.

Список похожих презентаций

Спид – что это такое?

Спид – что это такое?

С П И Д –. синдром приобретенного иммунодефицита; первая глобальная эпидемия, которая своими размерами перекрывает все эпидемии, которые перенесло ...
Что такое витамины и зачем они нужны

Что такое витамины и зачем они нужны

. Витамин А. Борется с бактериями и вирусами в нашем организме. Необходим для сохранения зрения. Делает кожу гладкой и красивой. Содержится:. В моркови ...
Что такое красная книга?

Что такое красная книга?

Есть ли своя Красная книга в Республике Коми? В Коми республике тоже есть такая книга. Она была составлена и издана в 1999 году сотрудниками Института ...
Модуль «что такое жизнь?»

Модуль «что такое жизнь?»

Чему посвящен модуль? Схемы взяты с главной страницы сайта 1314.ru. Движение в модуле. *Схема «зон знания» с сайта «Почемучкины вопросы» www.za4em.com. ...
Что такое экология ?

Что такое экология ?

Наша планета - Земля. sos. . . . . . . . . . . . . . . . . Интернет - ресурсы. 1. http://www.stihi.ru/2009/03/21/2268 Слайд 2, 19 2. http://www.glazey.ru/news/467/?page_7=85 ...
Что такое экология ?

Что такое экология ?

Этапы проведения проекта. Подготовительный этап. Создание творческих мастерских. Мозговой штурм. Постановка проблемы. Подбор материалов. Выбор инструментария ...
Что такое систематика

Что такое систематика

В итоге эволюционного процесса возникло то разнообразие форм жизни, которое мы наблюдаем при изучении современных и ископаемых видов животных, растений, ...
Что такое кровь

Что такое кровь

Человек – он ведь тоже природа, Он ведь тоже закат и восход. И четыре в нем времени года. И особый в нем музыки ход. Тест «Органы пищеварения. Кровеносная ...
Что такое ноосфера

Что такое ноосфера

С П Р А В К А. ГЕОЛОГИЯ – наука об истории развития Земли. ЭВОЛЮЦИЯ – история развития органического мира. НЕКОТОРЫЕ ТЕЗИСЫ, КАСАЮЩИЕСЯ УЧЕНИЯ О БИОСФЕРЕ. ...
Что такое почва

Что такое почва

Почва — поверхностный слой литосферы Земли, обладающий плодородием образовавшийся в результате выветривания горных пород и жизнедеятельности организмов. ...
Что такое моделирование?

Что такое моделирование?

1) Моделирование - это исследование объектов познания на их моделях; построение и изучение моделей реально существующих предметов и явлений, и конструируемых ...
Что такое нанотехнологии?

Что такое нанотехнологии?

Что такое НАНОТЕХНОЛОГИИ? Ричард Фейнман Норио Танигути. О нанотехнологиях. «нано» - карлик. Где занимаются нанотехнологиями? Курчавский институт. ...
Что такое кровь

Что такое кровь

Человек – он ведь тоже природа, Он ведь тоже закат и восход. И четыре в нем времени года. И особый в нем музыки ход. Тест «Органы пищеварения. Кровеносная ...
Что такое кровь?

Что такое кровь?

СКОРАЯ МЕДИЦИНСКАЯ ПОМОЩЬ. 03. ГЛАЗА, НОС, СЕРДЦЕ, ЛЁГКИЕ, ЖЕЛУДОК, НОСОГЛОТКА. ПИЩЕВОД, КРОВЬ, ЖЕЛУДОК, ПОЧКИ, ЧЕРЕП, ПОЗВОНОЧНИК. ГЛАЗА, АРТЕРИИ, ...
Что такое сновидения?

Что такое сновидения?

Сон. - периодически наступающее физиологическое состояние у человека и животных, характеризующееся обездвиженностью и почти полным отсутствием реакция ...
Что такое биология?

Что такое биология?

Биология (от греч. bios — жизнь и logos — учение), совокупность наук о живой природе. Предмет изучения — все проявления жизни: строение и функции ...
Что такое аллергия?

Что такое аллергия?

Проблема: рост и распространение аллергических заболеваний среди детей и взрослых. Актуальность темы:. аллергические заболевания (A3) являются одними ...
Что мы едим?

Что мы едим?

Содержание:. 1.Введение 2.Потребность в калориях у детей 3.Нормы школьного питания 4.Основные правила здорового питания школьников 5.Отношение к еде ...
Что у земли внутри

Что у земли внутри

Цель: Обобщить полученные знания по теме «Что у Земли внутри». I ЭТАП ИСТОРИЧЕСКИЙ. Раскройте гипотезу о возникновении Земли. Жорж Луи Бюффон. Иммануил ...
Что растёт на клумбе?

Что растёт на клумбе?

Клумба — это участок земли, на котором люди выращивают цветы. Клумбы можно разбивать на газонах, лужайках, перед домом. Гладиолус. означает «небольшой ...

Конспекты

Что за чудо – эти лишайники

Что за чудо – эти лишайники

Урок – путешествие в страну «Чулишанию» (6 кл.). Составитель: учитель высшей категории МОУ Селезянской СОШ Емельченкова Л.Г. Тема: «Что за чудо ...
Что называют почвой

Что называют почвой

. Областное государственное специальное (коррекционное) образовательное казенное учреждение для обучающихся, воспитанников с ограниченными возможностями ...
Организм как единое целое. Что мы узнали о строении живых организмов

Организм как единое целое. Что мы узнали о строении живых организмов

. Конспект урока биологии для 6 классапо теме. . . «Организм как единое целое. . . Что мы узнали о строении живых организмов». Мокеева ...

Советы как сделать хороший доклад презентации или проекта

  1. Постарайтесь вовлечь аудиторию в рассказ, настройте взаимодействие с аудиторией с помощью наводящих вопросов, игровой части, не бойтесь пошутить и искренне улыбнуться (где это уместно).
  2. Старайтесь объяснять слайд своими словами, добавлять дополнительные интересные факты, не нужно просто читать информацию со слайдов, ее аудитория может прочитать и сама.
  3. Не нужно перегружать слайды Вашего проекта текстовыми блоками, больше иллюстраций и минимум текста позволят лучше донести информацию и привлечь внимание. На слайде должна быть только ключевая информация, остальное лучше рассказать слушателям устно.
  4. Текст должен быть хорошо читаемым, иначе аудитория не сможет увидеть подаваемую информацию, будет сильно отвлекаться от рассказа, пытаясь хоть что-то разобрать, или вовсе утратит весь интерес. Для этого нужно правильно подобрать шрифт, учитывая, где и как будет происходить трансляция презентации, а также правильно подобрать сочетание фона и текста.
  5. Важно провести репетицию Вашего доклада, продумать, как Вы поздороваетесь с аудиторией, что скажете первым, как закончите презентацию. Все приходит с опытом.
  6. Правильно подберите наряд, т.к. одежда докладчика также играет большую роль в восприятии его выступления.
  7. Старайтесь говорить уверенно, плавно и связно.
  8. Старайтесь получить удовольствие от выступления, тогда Вы сможете быть более непринужденным и будете меньше волноваться.

Информация о презентации

Ваша оценка: Оцените презентацию по шкале от 1 до 5 баллов
Дата добавления:14 сентября 2014
Категория:Биология
Автор презентации:С.А. Спирин
Содержит:23 слайд(ов)
Поделись с друзьями:
Скачать презентацию
Смотреть советы по подготовке презентации