» » » Что такое биоинформатика?
Что такое биоинформатика?

Презентация на тему Что такое биоинформатика?

Презентацию на тему Что такое биоинформатика? можно скачать абсолютно бесплатно на нашем сайте. Предмет презентации : Биология. Красочные слайды и илюстрации помогут вам заинтересовать своих одноклассников или аудиторию. Для просмотра содержимого презентации воспользуйтесь плеером, или если вы хотите скачать презентацию - нажмите на соответствующий текст под плеером. Презентация содержит 23 слайда.

Слайды презентации

Слайд 1: Презентация Что такое биоинформатика?
Слайд 1

Что такое биоинформатика? Банк SwissProt

С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ

Слайд 2: Презентация Что такое биоинформатика?
Слайд 2

Что такое биоинформатика?

Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.

Слайд 3: Презентация Что такое биоинформатика?
Слайд 3
Слайд 4: Презентация Что такое биоинформатика?
Слайд 4

Примеры задач биоинформатики

Разработка алгоритмов для анализа большого объема биологических данных Алгоритм поиска генов в геноме Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами. Изучение структуры активного центра белка Разработка программного обеспечения для управления и быстрого доступа к биологическим данным Создание банка данных аминокислотных последовательностей

Слайд 5: Презентация Что такое биоинформатика?
Слайд 5

Что понимать под биоинформатикой?

Как видим, смысл термина ещё ỳже...

Применение компьютерных методов для решения биологических задач

Применение компьютерных методов для решения задач молекулярной биологии

... и еще ỳже...

Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации

Слайд 6: Презентация Что такое биоинформатика?
Слайд 6

Биоинформатика = вычислительная молекулярная биология

Почему так сузился смысл термина?

Слайд 7: Презентация Что такое биоинформатика?
Слайд 7

gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa

Слайд 8: Презентация Что такое биоинформатика?
Слайд 8

В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК

Организм ДНК «в пробирке»


выделение секвенирование ...TGCCACAAATCAC...
Слайд 9: Презентация Что такое биоинформатика?
Слайд 9

Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank

GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’а: 1982: 680 338 букв в 606 последовательностях 1992: 101 008 486 букв в 78 608 последовательностях 2002: 28 507 990 166 букв в 22 318 883 последовательностях 2004: 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~165 000 организмов) Размер файлов — 196 Gb

Слайд 10: Презентация Что такое биоинформатика?
Слайд 10

Пионеры биоинформатики

Лайнус Полинг 1962

Zuckerkandl, E., and L. Pauling. 1962. Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965. Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166.

Анализ аминокислотных последовательностей глобинов нескольких позвоночных Гипотеза молекулярных часов

Слайд 11: Презентация Что такое биоинформатика?
Слайд 11
Маргарет Дейхофф

Однобуквенный код аминокислот A,C,D,E,F,G,H… Матрицы аминокислотных замен PAM (Point Accepted Mutation)


Атлас последовательностей белков и их структур (1965)

Слайд 12: Презентация Что такое биоинформатика?
Слайд 12

Первый “банк данных”

Атлас белковых последовательностей и их структур

1965 -1978

Первая версия атласа содержала описание 65 (!) последовательностей белков

Слайд 13: Презентация Что такое биоинформатика?
Слайд 13
Банки данных

Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор Курируемые за содержание записей отвечают специальные люди — кураторы Автоматические записи генерируются компьютерными программами

Слайд 14: Презентация Что такое биоинформатика?
Слайд 14
Банк данных Swiss-Prot 1986

Swiss-Prot – база знаний о белковых последовательностях


Курируемая база данных “Золотой стандарт” аннотации

Слайд 15: Презентация Что такое биоинформатика?
Слайд 15
Амос Байрох

Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики

С 1987 поддерживается в сотрудничестве между Swiss Institute of Bioinformatics (SIB) European Bioinformatics Institute (EBI)

Слайд 16: Презентация Что такое биоинформатика?
Слайд 16

Статистика роста количества документов

Текущий релиз 48.9 (24 января 2006) содержит 206586 документов

2006 2001
Слайд 17: Презентация Что такое биоинформатика?
Слайд 17
Банк данных TrEMBL

Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация

TrEMBL (Translated EMBL)

Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа

Слайд 18: Презентация Что такое биоинформатика?
Слайд 18

Тенденция объединения

Слайд 19: Презентация Что такое биоинформатика?
Слайд 19
Банк данных UniProt

UniProt (Universal Protein Resource)

UniProt Knowlegebase – SwissProt+TrEMBL UniProt Archive – UniParc UniProt Reference – UniRef

Слайд 20: Презентация Что такое биоинформатика?
Слайд 20

~2 500 000 последовательностей

компьютерный поиск гена, трансляция и компьютерная аннотация

UniRef (UniProt non-redundant Reference databases)

PIR-PSD UniParc (UniProt Archive)

200 000 последовательностей


Базы данных научной литературы

Слайд 21: Презентация Что такое биоинформатика?
Слайд 21

Соотношение числа белков, представленных в разных банках

3 078 524 33 321 206 586

Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!

Слайд 22: Презентация Что такое биоинформатика?
Слайд 22

Документ банка данных Swiss-Prot

Описание документа: идентификатор, имя, дата создания и модификации

Аннотация последовательности

Слайд 23: Презентация Что такое биоинформатика?
Слайд 23

Основные поля записи SwissProt


И сама последовательность, конечно.

Другие презентации по биологии

  • Яндекс.Метрика
  • Рейтинг@Mail.ru