» » » Что такое биоинформатика

Презентация на тему Что такое биоинформатика

Здесь Вы можете скачать готовую презентацию на тему Что такое биоинформатика. Предмет презентации: Информатика. Красочные слайды и илюстрации помогут вам заинтересовать своих одноклассников или аудиторию. Для просмотра содержимого презентации воспользуйтесь плеером, или если вы хотите скачать презентацию - нажмите на соответствующий текст под плеером. Презентация содержит 23 слайда.

Слайды презентации

Слайд 1
Что такое биоинформатика? Банк SwissProt С.А.Спирин 7, 8,10 февраля 2006 г., ФББ МГУ
Слайд 2
Что такое биоинформатика? • Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). • Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). • Применение компьютерных методов для решения биологических задач. • Телепатия, парапсихология, информационные поля и т.п. ?
Слайд 3
Биоинформатика Исследование информационных процессов в биологических системах (клетках, органах, организме, популяции). Изучение и внедрение в компьютерную науку «биологических» методов анализа информации (нейросетей, генетических алгоритмов, нечеткой логики и др.). Применение компьютерных методов для решения биологических задач. Телепатия, парапсихология, информационные поля и т.п.
Слайд 4
Примеры задач биоинформатики • Разработка алгоритмов для анализа большого объема биологических данных – Алгоритм поиска генов в геноме • Анализ и интерпретация биологических данных таких, как нуклеотидные и аминокислотные последовательности, структура молекул белков, структура комплексов молекул белков с другими молекулами. – Изучение структуры активного центра белка • Разработка программного обеспечения для управления и быстрого доступа к биологическим данным – Создание банка данных аминокислотных последовательностей
Слайд 5
Что понимать под биоинформатикой? Как видим, смысл термина ещё ỳже... Применение компьютерных методов для решения биологических задач Применение компьютерных методов для решения задач молекулярной биологии ... и еще ỳже... Компьютерный анализ экспериментальных данных о структурах биологических макромолекул (белков и нуклеиновых кислот) с целью получения биологической информации
Слайд 6
Итак... Биоинформатика = вычислительная молекулярная биология Почему так сузился смысл термина?
Слайд 7
gatcctccatatacaacggtatctccacctcaggtttagatctcaacaacggaaccattg ccgacatgagacagttaggtatcgtcgagagttacaagctaaaacgagcagtagtcagct ctgcatctgaagccgctgaagttctactaagggtggataacatcatccgtgcaagaccaa gaaccgccaatagacaacatatgtaacatatttaggatatacctcgaaaataataaaccg ccacactgtcattattataattagaaacagaacgcaaaaattatccactatataattcaa agacgcgaaaaaaaaagaacaacgcgtcatagaacttttggcaattcgcgtcacaaataa attttggcaacttatgtttcctcttcgagcagtactcgagccctgtctcaagaatgtaat aatacccatcgtaggtatggttaaagatagcatctccacaacctcaaagctccttgccga gagtcgccctcctttgtcgagtaattttcacttttcatatgagaacttattttcttattc tttactctcacatcctgtagtgattgacactgcaacagccaccatcactagaagaacaga acaattacttaatagaaaaattatatcttcctcgaaacgatttcctgcttccaacatcta cgtatatcaagaagcattcacttaccatgacacagcttcagatttcattattgctgacag ctactatatcactactccatctagtagtggccacgccctatgaggcatatcctatcggaa aacaataccccccagtggcaagagtcaatgaatcgtttacatttcaaatttccaatgata cctataaatcgtctgtagacaagacagctcaaataacatacaattgcttcgacttaccga gctggctttcgtttgactctagttctagaacgttctcaggtgaaccttcttctgacttac tatctgatgcgaacaccacgttgtatttcaatgtaatactcgagggtacggactctgccg acagcacgtctttgaacaatacataccaatttgttgttacaaaccgtccatccatctcgc tatcgtcagatttcaatctattggcgttgttaaaaaactatggttatactaacggcaaaa acgctctgaaactagatcctaatgaagtcttcaacgtgacttttgaccgttcaatgttca ctaacgaagaatccattgtgtcgtattacggacgttctcagttgtataatgcgccgttac ccaattggctgttcttcgattctggcgagttgaagtttactgggacggcaccggtgataa actcggcgattgctccagaaacaagctacagttttgtcatcatcgctacagacattgaag gattttctgccgttgaggtagaattcgaattagtcatcggggctcaccagttaactacct ctattcaaaatagtttgataatcaacgttactgacacaggtaacgtttcatatgacttac ctctaaactatgtttatctcgatgacgatcctatttcttctgataaattgggttctataa
Слайд 8
В конце 1970-х годов был изобретён относительно быстрый и дешёвый метод экспериментального определения последовательности оснований в ДНК Организм ДНК «в пробирке» Последовательность выделение секвенирование ...TGCCACAAATCAC...
Слайд 9
Для хранения все возрастающей информации о последовательностях ДНК в 1982 году был основан GenBank GenBank — хранилище последовательностей нуклеиновых кислот в виде компьютерных файлов Объем GenBank’ а : 1982 : 680 338 букв в 606 последовательностях 1992 : 101 008 486 букв в 78 608 последовательностях 2002 : 28 507 990 166 букв в 22 318 883 последовательностях 2004 : 44 575 745 176 букв в 40 604 319 последовательностях 2005: 56 037 734 462 букв в 52 016 762 последовательностях (из ~ 165 000 организмов) Размер файлов — 196 Gb
Слайд 10
Пионеры биоинформатики Лайнус Полинг 1962 Zuckerkandl, E., and L. Pauling. 1962 . Molecular disease, evolution, and genic heterogeneity. Horizons in Biochemistry, Academic Press, New York, 189-225. Zuckerkandl, E., and L. Pauling. 1965 . Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins, Academic Press, New York, 97-166. • Анализ аминокислотных последовательностей глобинов нескольких позвоночных • Гипотеза молекулярных часов
Слайд 11
Пионеры биоинформатики Маргарет Дейхофф • Однобуквенный код аминокислот A,C,D,E,F,G,H… • Матрицы аминокислотных замен PAM (Point Accepted Mutation) 1965 Атлас последовательностей белков и их структур (1965)
Слайд 12
Первый “ банк данных ” Атлас белковых последовательностей и их структур 1965 -1978 Первая версия атласа содержала описание 65 (!) последовательностей белков
Слайд 13
Банки данных • Архивные (примеры: PDB, GenBank) за содержание каждой записи отвечает её автор-экспериментатор • Курируемые за содержание записей отвечают специальные люди — кураторы • Автоматические записи генерируются компьютерными программами
Слайд 14
Банк данных Swiss-Prot 19 8 6 Swiss-Prot – база знаний о белковых последовательностях http://www.expasy.org/sprot/ • Курируемая база данных • “ Золотой стандарт ” аннотации
Слайд 15
Банк данных Swiss-Prot Амос Байрох Руководитель группы Swiss-Prot в Швейцарском Институте Биоинформатики С 1987 поддерживается в сотрудничестве между S wiss I nstitute of B ioinformatics ( SIB ) E uropean B ioinformatics I nstitute ( EBI )
Слайд 16
Банк данных Swiss-Prot Статистика роста количества документов Текущий релиз 48.9 (2 4 января 2006) содержит 206586 документов 1986 2006 2001
Слайд 17
Банк данных TrEMBL Формальная трансляция всех кодирующих нуклеотидных последовательностей из банка EMBL Автоматическая классификация и аннотация TrEMBL ( Tr anslated EMBL ) Текущий релиз 31.9 (24 января 2006) содержит 2 586 884 документа
Слайд 18
Тенденция объединения 2002
Слайд 19
Банк данных UniProt UniProt ( Uni versal Prot ein Resource ) • UniProt Knowlegebase – SwissProt + TrEMBL • UniProt Archive – UniParc • UniProt Reference – UniRef
Слайд 20
~2 500 000 последовательностей компьютерный поиск гена, трансляция и компьютерная аннотация UniRef (UniProt non-redundant Reference databases) UniParc ( UniProt Archive ) 200 000 последовательностей Экспертиза Базы данных научной литературы
Слайд 21
Соотношение числа белков, представленных в разных банках 3 078 524 33 321 206 586 Последовательностей во много раз больше, чем структур! Большинство последовательностей не аннотированы!
Слайд 22
Документ банка данных Swiss-Prot Описание документа: идентификатор, имя, дата создания и модификации Аннотация последовательности Последовательность
Слайд 23
Основные поля записи SwissProt • ID • AC • DE • OS • OC И сама последовательность, конечно.

Другие презентации по информатике

  • Яндекс.Метрика
  • Рейтинг@Mail.ru