Презентация "Diferenciace heterocyst" – проект, доклад

Diferenciace heterocyst Martin Tichý Martin Tichý

Institute of Microbiology, Czech Academy of Sciences, Třeboň Institute of Physical Biology, University of South Bohemia, Nové Hrady Czech Republic

Anabaena sp. PCC 7120 je Nostoc heterocysty nejsou cysty

Paradox of developmental biology How is it that a single cell gives rise to a multicellular organism composed of 100s of different cell types – yet all the cell types have the same genes?

Patterning can involve the interpretation of positional information.

French flag analogy

Figure 21-63. Two strategies for using signal concentration gradients to specify a fine-grained pattern of cells in different states. In (A) there is only one signal gradient, and cells select their states by responding accurately to small changes of signal concentration. In (B) the initial signal gradient controls establishment of a small number of more local signals, which control establishment of other still more narrowly local signals, and so on. Because there are multiple local signals, the cells do not have to respond very precisely to any single signal in order to create the correct spatial array of cell states. Case B corresponds more closely to the strategy of the real embryo.

Expression of eve Stripe 2

Figure 21-65. The formation of ftz and eve stripes in the Drosophila blastoderm. Genes ftz and eve are both pair-rule genes. Their expression patterns (shown in brown for ftz and in gray for eve) are at first blurred but rapidly resolve into sharply defined stripes. (From P.A. Lawrence, The Making of a Fly. Oxford, UK: Blackwell, 1992.)

The Course of Development

Time Events in time and space . . . Complicated

Really

Matveyev and Elhai (unpublished) N2 Cyanobacteria

Anabaena grown without fixed nitrogen

How Cyanobacteria Count to 10 Robert Haselkorn

Jak každá desátá buňka ví že má být heterocystou

Fixace dusíku

N2 + 8H+ + 8e- + 16ATP --> 2NH3 + H2 + 16ADP + 16Pi Note: Very expensive Reason why N2 fixation by heterotrophic microbes is probably low Key enzyme: nitrogenase (nif) Ancient enzyme: highly conserved in very diverse microbes, from archaea to cyanobacteria

Biochemistry of N2 fixation

What is another problem with nitrogenase?

Nitrogenase is killed dead by O2 Protects nitrogenase (N2 fixing enzyme) from O2 Outside sources of O2 O2 produced by cyanobacteria

Ne všechny sinice schopné fixovat dusík tvoří heterocysty

How does Trichodesmium (and single cell cyano’s) fix N2 without heterocysts?

Partial answer: doesn’t fix N2 and do photosynthesis at the same time See Berman-Frank et al. Science (2001) 294: 1534-1537.

1. Site of N2 fixation in many cyanobacteria. 2. Specialized thick wall cells in chain of cyanobacterial vegetative cells 3. No PS II of photosynthesis --> no O2 evolution 4. No carbon fixation 5. Respiration

What are heterocysts?

The heterocyst achieves a near anoxic state by at least three means. First, photosystem II, the O2-producing end of the photosynthetic electron transport chain, is dismantled during heterocyst differentiation, so that the heterocyst need contend only against O2 produced by neighboring vegetative cells and that dissolved in the environment. Second, heterocysts are invested with a specialized envelope that limits the influx of gases. Two layers within the envelope have been implicated in O2 protection: an inner layer composed of a hydroxylated glycolipid and an outer layer of polysaccharide. Neither layer is found in vegetative cells. Third, much of the O2 that overcomes these barriers is consumed by the high oxidase activity associated with heterocysts.

Dělba práce

Excitation was at 510 to 560 nm (green), exciting phycoerythrin, and emission was greater than 600 nm. Heterocysts have negligible fluorescence, while vegetative cells have intense combined fluorescence from phycobiliproteins and chlorophyll a. Bar, 10 µm.

A médium s dusíkem B médium bez dusíku

Anabaena filament growing on nitrate

Anabaena filament growing on N2 removal of nitrate 18 hours Heterocysts only when needed

Anabaena heterocyst cells vegetative cells

Anabaena model

Heterocyst spacing relatively constant Heterocyst cells produce compound Vegetative cells divide differentiate consume compound diffuse compound

First, they assumed that any cell is competent to differentiate at the moment when nitrogen is removed from the environment and that the choice of cells that initiate differentiation is random. Second, they postulated the existence of a diffusible inhibitor made by heterocysts and differentiating cells and consumed by nondifferentiating cells, as predicted by experimental data.

Anabaena – continuous model

axiom: Fh(smax,cmax) Fv(smax,cmax) Fh(smax,cmax) F(sl,cl) F(sr,cr): if s cmin solve dc/dt = D.(cl+cr-2c)-µ.c ds/dt = r . s if s = smax & c > cmin produce Fv(k . smax,c)Fv((1-k) . smax,c) if c = cmin produce Fh(s,c) Fh(s,c): solve ds/dt = rs . (smax-s) dc/dt = rc . (cmax-c)

Case of the Hidden Heterocyst NH3 O2

Strategy to find heterocyst differentiation genes

1. Use transposon mutagenesis

Nostoc genome Transposon

to find a mutant defective in heterocyst differentiation

2. Sequence out from transposon

AAGCTTGACCAAAAAGTTAAAACACTGACGGCAAATAATCAATGACTATCAGACAGAGAATCATCGTGCTGTCAGTAAAACCTCTGATTTCGATCTTTACCATAATTGTTATGTTGTAATGACTAACCAGACTATCTTTTACAGAGCTTCTGGTTAACACTTGTCTAATTAGACATTGATAATGTTTGTGGGGGTTGGTCATCAGGAATGGTAAATAGCAATTACCCTTCAGACTTTCCTATGAGACGCTCCGCCAACGAGCAGTGTCTCTTAAAGAACGTTATGAGCGCTCAGTTAACTTCAGAAATTCACGGCGGAAATCCATAGTTATTATTACTTATGACTAAAACAAAATTACTATGGCGGCTTGTTTAATATAGATTCTGTGTTCTGAGAAATGACTTTTAAAGTCCCACTAACTTTTTTCTCATCTATTGCTATATTTCGACTTTAAAACTTATAGTAGATGGCTTAATTCTCAAATAACAAACTCATTTTTAGTAGATATTTCATGCAAACTGAGGTTTTTAGTGATATTTTCCCCTTATTGAGTACAGCCACTCCACAAACCTTAGAATGGCTACTCAATATTGCAATTGATCATGAATATCCCACTGGTAGAGCAGTTTTAATGGAAGATGCCTGGGGTAATGCAGTTTATTTCGTTGTATCTGGATGGGTAAAAGTTCGGCGCACCTGTGGA

3. Find gene boundaries 4. Identify gene Do it

HetR

mutant - unable to make heterocysts The spatially patterned differentiation of heterocysts in the filamentous cyanobacterium Anabaena requires a functional hetR gene low level of transcript when Anabaena is grown with combined nitrogen induction begins within 2 h following nitrogen deprivation by 3.5 h, induction is localized to spaced foci by 6 h, 20-fold increase within spatially separated cells positive autoregulation

Genes needed for differentiation Master regulator

Differentiation in cyanobacteria Integration of signals through HetR

Position in filament Position in cell cycle Nitrogen deprivation ???? ??

Promoter

NNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN

hetR gene How might hetR be controlled?

5’-GTANNNTACNNNNNNNNNNTANNNTNNNNNNNNNN 3’-CATNNNATGNNNNNNNNNNATNNNANNNNNNNNNN

Presence of fixed nitrogen No HetR protein Transcription Absence of fixed nitrogen

RNA Polymerase

HetR protein

The key result of this experiment is that all of the upstream controls of HetR expression can be bypassed; expression of HetR alone suffices to turn on the differentiation pathway.

HetR overexpression

PatS

overexpression of patS completely blocks heterocyst development patS encode a 17- or 13-amino-acid peptide, is crucial for the formation and maintenance of the normal heterocyst pattern

Wild-type filaments (A) grown in BG-11 medium and (B) after the nitrogen step-down in BG-110 to induce heterocysts (arrowheads) are shown. (C) Overexpression of patS prevented heterocyst formation in BG-110, and (D) deletion of patS resulted in supernumerary heterocysts with an abnormal pattern in BG-110. Differential interference contrast micrographs were taken before (A) and 24 hours after (B through D) heterocyst induction.

patS controls heterocyst development in Anabaena PCC 7120

The exogenous addition of a pentapeptide corresponding to the last five COOH-terminal residues of PatS also inhibited heterocyst differentiation, indicating that a processed form of PatS may be a diffusible inhibitory signal regulating development.

R G S G R

Přesně jako v modelu z roku 1975

The inhibition of neighboring cells by select differentiating cells (lateral inhibition) is an important mechanism of pattern formation in eukaryotic organisms.

Because it takes ~20 hours for heterocysts to mature and begin supplying fixed nitrogen to the filament, a specialized early inhibitory signal is required to allow only a fraction of starving cells to terminally differentiate. The first cells to differentiate increase the production of PatS to inhibit neighboring cells from forming heterocysts. PatS-producing cells must themselves be refractory to the PatS signal.

+ Nostoc punctiforme Anthoceros punctatus.

Další události nezbytné k aktivaci nif genů