Презентация "Genomes & Genomics" – проект, доклад

Genomes & Genomics

Genome, the entire genetic complement of an organism Genomics, research that addresses all or a substantial portion of an organism’s genome Includes physical mapping & sequencing of all or a large part of a genome or chromosome

Why Study Genomes of Different Organisms? To understand the genetics behind diseases (Homo sapien & Canis familiarus) To learn more about human pathogens & how to prevent or treat their infections (Clostridium tetani, Bacillus anthacis, & Haemophilus influenzae) Understand & improve the genetics of commercial organisms (Lactococcus lactis, Oryza sativa, Bos taurus, & Gallus gallus) To discover the workings of unusual or odd organisms (Bdellovibrio bacteriovorus & Deinococcus radiodurans) To understand phyolegeny

How Many Genomes Have Been Sequenced?

Completed Draft In Progress Eukaryote 24 129 182 Archaea 46 4 27 Eubacteria 521 414 402 Viral 1703 (NCBI 9/4/07)

How Do We Measure a Genome? 1 base=1 nucleotide=1basepair (bp) 1000bases=1kilobase (Kb) 1000kb=1megabase (Mb) 1000mb=1gigabase (Gb)

Genome Sizes (haploid) Organism Genome in Mb E. coli 4.64 Yeast 12 Nematode 97 Fruit Fly 170 Pufferfish 345 Human 3200 Lungfish 129000

105 106 107 108 109 1010 1011 1012 basepairs

Amount of DNA in a Genome Does Not Correlate with Complexity

http://www.ornl.gov/sci/techresources/Human_Genome/publicat/primer/fig14.html

http://www.chromosome18.org/graphics/Slide.gif http://uk.encarta.msn.com/media_121636626/Fruit_Fly_Chromosomes.html

Genomes Are Organized Into Chromosomes

Human Fruit Fly

Chromosome Number Is Species Specific

Diploid Number 2n Human 46 Mouse 40 Fruit Fly 8 Dog 78 Arabidopsis 10 Corn 20 Yeast 32 Crayfish 200

How many genes do we have? Original estimate was between 50 000 to 100 000 genes We now think human have ~ 25 000 genes How does this compare to other organisms? Mice have ~30 000 genes Pufferfish have ~35 000 gene The nematode (C. elegans), has ~19 000 Yeast (S. cerevisiae) there are ~6000 genes The microbe responsible for tuberculosis has ~4000

http://www.mun.ca/biology/desmid/brian/BIOL2250/Week_Two/genespac.jpg

Gene Spacing in Various Species

Even the Amount of DNA a Gene Spans Differs Amongst Species

Comparative Genomics

Yeast

70 human genes are known to repair mutations in yeast Nearly all we know about cell cycle and cancer comes from studies of yeast Advantages: fewer genes (6000) few introns 31% of yeast genes give same products as human homologues

Drosophila

nearly all we know of how mutations affect gene function come from Drosophila studies We share 50% of their genes 61% of genes mutated in 289 human diseases are found in fruit flies 68% of genes associated with cancers are found in fruit flies Knockout mutants Homeobox genes

C. elegans

959 cells in the nervous system 131 of those programmed for apoptosis apoptosis involved in several human genetic neurological disorders Alzheimers Huntingtons Parkinsons

Mouse

known as “mini” humans Very similar physiological systems Share 90% of their genes

What is the rest of the human genome made up of? Regulatory regions of DNA that turn genes on or off Repetitive DNA sequences: Tandem Repetitive Sequences (~10%) Microsatellite DNA: 2 to 4bp long repeats Minisatellite DNA: 20bp or longer repeats Macrosatellite DNA: megabase long repeats Transposable elements SINEs and LINEs 35% Retroviral fossils

Genetic vs. Physical Mapping

Genetic mapping based on genetic techniques, maps show the positions of diseases or traits based on recombination frequencies Genetic techniques include cross-breeding experiments or, the examination of family histories (pedigrees) Physical mapping uses molecular biology techniques to examine DNA molecules directly to construct maps showing the positions of sequence features, including genes Physical techniques include DNA restriction enzyme analysis & fluorescent tagging of chromosomal regions

http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/images/98-1455.jpg

Genetic Map showing the location of disease genes on human chromosome 4

Human chromosomes stained to show bands of different DNA These bands are the roughest markers for physical mapping

Fluorescent Labeling of Chromosomes

http://www.mun.ca/biology/scarr/FISH_chromosome_painting.htm

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=hmg.figgrp.1556

Types of Physical Maps For Chromosome 21

http://freepages.genealogy.rootsweb.com/~patafordgenealogy/images/usmaphyperlinks.jpg http://socialstudies.ccswebacademy.net/CivicsEconomicsJenkins/images/Map_Outline_US_Outline.jpg

The more markers better the resolution, the more useful the map

DNA Sequencing

Polyacrylamide gel electrophoresis can resolve ssDNA molecules that differ in length by just one nucleotide A banding pattern is produced after separation of ssDNA molecules by denaturing polyacrylamide gel electrophoresis

Automatic Sequencing Machines use fluorescent dyes

Fluorescent Dye Dideoxy-sequencing

http://www.ornl.gov/TechResources/Human_Genome/graphics/slides/ttseqfacility.html

DNA Sequencers in Action

First Complete Sequence of a Free-Living Organism

1995, the Haemophilus influenzae genome sequenced Genome size=1830 kb 1st genome sequenced using the shotgun method 28,643 sequencing experiments totaling 11,631,485 bp This equaled 6x the length of the H. influenzae genome Sequence assembly 30 hrs on a computer with 512 Mb of RAM Resulted in 140 lengthy contiguous sequences Each sequence contig represented, non-overlapping portion of the genome

1st proposed by the DoE 1984 By 1990, the Human Genome Project was launched The Human Genome Organization (HUGO) was founded to provide a forum for international coordination of genomic research The program was proposed to include: The creation of genetic & physical maps to be used in the generation of a complete genome sequence

Human Genome Project

First Steps of the Human Genome Project 1) Construct genetic & physical maps of the haploid human & mouse genomes These would provide key tools for identification of disease genes and anchoring points for genomic sequence 2) Sequence the yeast and worm genomes, as well as targeted regions of mammalian genomes

Sequencing Plan of HUGO 1) Isolate each human chromosome 2) Physical mapping of each chromosome The banding pattern of visible through staining Location of known genes already mapped Location of restriction enzyme sites Chromosome fragmented into large pieces of DNA and inserted into BAC or YAC libraries Fragments overlap such that they can be ordered into a rough assembly of the chromosome DNA from 5 humans 2 males, 3 females 2 caucasians, one each of asian, african, hispanic

Each YAC or BAC is fragmented into smaller 1 to 2 kb pieces of DNA which are sequenced Each of these fragments slightly overlaps with each other A computer takes the DNA sequences & looks for regions of overlap these are connected to form a sequence contig for the entire BAC or YAC The sequence of all the YACs or BACs are assembled through the same process to give the sequence of the chromosome This is repeated for all 22 chromosomes plus the X & Y

Hierarchical Shotgun Approach

http://www.genome.ou.edu/3653/3653-101705.html

Separate Individual Chromosomes

http://www.csmc.edu/csri/korenberg/chroma11.html

Chromosome 11 BACs

1999, Celera Genomics, set out to sequence the human genome using a whole-genome shotgun method - more riskier - goal to patent some seq. There would be no isolation of individual chromosomes & no subcloning into BACs or YACs They skipped straight to the 1 to 2 kb fragments The $300 million Celera effort was intended to proceed at a faster pace and at a fraction of the cost of the roughly $3 billion HUGO project.

Dr. Craig Venter (founder) Celera Genomics

Human Genome Whole-Genome Shotgun Method

14.8-billion bp of DNA sequence was generated over 9 months This equaled 5x the human genome Resulting sequence contigs spanned >99% of the genome In March 2000, President Clinton announced that the genome sequences could not be patented, and should be made freely available to all researchers. The statement sent Celera's stock plummeting. The competition proved to be very good for the project, spurring the public groups to modify their strategy in order to accelerate progress. In February 2001 Celera Genomics published their draft of the human genome in the journal Science The same month HUGO published its draft of the human genome in the journal Nature The rivals initially agreed to pool their data, but the agreement fell apart when Celera refused to deposit its data in the unrestricted public database GeneBank.

http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=genomes.figgrp.6211

Whole-Genome Shotgun Approach

Celera took multiple copies of the genome fragmented them into 1 to 2kb fragments which where sequenced without concern for what chromosome they belonged to

What did they learn? 1.1% of the genome is spanned by exons 24% is in introns 75% of the genome is intergenic DNA A random pair of human haploid genomes differs on average at a rate of 1 bp per 1250 bp

Preliminary Functional Analysis of >26 000 genes >12 000 (41%) have no known function

S. Barnum, 2005 Biotechnology, An Introduction. Brookes/Cole

Diploid Genome Sequence of an Individual Human

On September 4th, 2007, a team led by Craig Venter, published his (ovn) complete DNA sequence, unveiling the six-billion-letter genome of a single individual for the first time. 44% of known genes had one or more alterations >0.5% variation between two haploid genomes

How Do We Differ? Total of 4.1 million DNA variations 3.2 million single nucleotide changes 53,800 block substitutions (2 to 206bp) 292,000 heterozygous insertion/deletions (1 to 571bp) 559,000 homozygous insertion/deletions (1 to 82,711bp) 90 inversions Numerous duplications & copy number variations

The UCSC Genome Browser

The browser takes you from early maps of the genome . . .

. . . to a multi-resolution view . . .

. . . at the gene cluster level . . .

. . . the single gene level . . .

. . . the single exon level . . .

. . . and at the single base level

caggcggactcagtggatctggccagctgtgacttgacaag caggcggactcagtggatctagccagctgtgacttgacaag

Other –omics Proteomics Transcriptomics Metabolomics Glycomics Epigenomics Metagenomics